⚡ This is your brand? Claim your page free and bring it to life on AI search.
AEO Score: 4/10
COMMENTS ACATCTGCTATAAAATACGATGCAGTCACGT or select FASTA format file Compress result TFBIND : Software for searching transcription factor binding sites (including TATA boxes, GC boxes, CCAAT boxes, transcription start sites (TSS)).
Category: Technology
tfbind.hgc.jp1
Structured Data
6
Content Structure
4
Entity Clarity
3
E-E-A-T Signals
5
Technical AEO
2
AI Discoverability
Is this your brand?
Claim your free page to manage and improve your AI visibility score.
Tech buyers are the most research-intensive shoppers on the internet.
Continue reading in your free Engagemii portalFree signup unlocks the full article plus your personalized AEO fix list for TFBIND INPUT.
Scored by Engagemii on May 26, 2026. Methodology: engagemii.com/aeo/methodology
Source URL: https://engagemii.com/aeo/brands/tfbind-hgc-jp
Cite this score: Engagemii (2026). "AEO Score for TFBIND INPUT." Retrieved from https://engagemii.com/aeo/brands/tfbind-hgc-jp
Licensed under CC BY 4.0. You may reuse this data with attribution: a visible link to engagemii.com.
Powered by Engagemii - AI Brand Discovery and AEO Platform